yobE

yobE
168

similar to general secretion pathway

locus
BSU_18880
Molecular weight
25.09 kDa
pI
5.04
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yobE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2135

This gene is a member of the following regulons

The protein
Protein family
[wiki|SOS response-associated peptidase family] (according to UniProt)
Structure
[PDB|2F20] (from Bacteroides thetaiotamicron, 35% identity)
[AF|O34915]
Paralogous protein(s)
[protein|9459834886B4943D514137F0E51536C771154183|yoqW], [protein|46FCB8FC703E61ED6578DFE4D3FC01B9421F8247|yoaM]
Biological materials
Mutant
MGNA-B406 (yobE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1405 NBRP B. subtilis, Japan]
BKE18880 (Δ[gene|B01C362825EB84DAD70CAF2C2500DE7D3EE68E5C|yobE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATCATCCTTTAGG,  downstream forward: _UP4_TAAGTACCACTGCCATATCG
BKK18880 (Δ[gene|B01C362825EB84DAD70CAF2C2500DE7D3EE68E5C|yobE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATCATCCTTTAGG,  downstream forward: _UP4_TAAGTACCACTGCCATATCG

B01C362825EB84DAD70CAF2C2500DE7D3EE68E5C

Page visits: 1040

Time of last update: 2022-12-02 16:43:00

Author of last update: Melvin.boenninger