cwlD

cwlD
168

N-acetylmuramoyl-L-alanine amidase, spore cortex peptidoglycan synthesis

locus
BSU_01530
Molecular weight
26.86 kDa
pI
9.79
Protein length
Gene length
function
spore cortex peptidoglycan synthesis
product
N-acetylmuramoyl-L-alanine amidase
essential
no
ec
3.5.1.28
synonyms
cwlD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0860

This gene is a member of the following regulons

Gene
Coordinates
156,612 → 157,325
The protein
Catalyzed reaction/ biological activity
formation of muramic acid delta-lacton in spore cortex peptidoglycan [Pubmed|14679227]
Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
Protein family
[wiki|N-acetylmuramoyl-L-alanine amidase 3 family] (according to UniProt)
[wiki|Domains]
contains an amidase_3 domain (like [protein|5CDF32B0E78F01C696364555E3F0BC8DF2AA2089|cwlC], [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC], [protein|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|yqiI], [protein|BE34A9CE3AF99E8880FC24E34E5D79A1627260AE|yrvJ])
[wiki|MurNAc-LAA domain] (aa 43-226) (according to UniProt)
Structure
[PDB|4RN7] (from Clostridium difficile, 30% identity, aa 43 - 234)
[AF|P50864]
[wiki|Localization]
secreted (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]-[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]
description
[Pubmed|7559346]
regulation
expressed during sporulation ([protein|search|SigG]) [Pubmed|7559346]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,7559346], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]→[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]

2023-01-19 14:20:39

ghost

41

4f94f75e692055c74b40e3a962d570a6ee8c5661

383CCC0DCD3BEF5EE74EDF98931A9661F9EE0C1D

genes
[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]
description
[Pubmed|7559346]
regulation
expressed during sporulation ([protein|search|SigG], [protein|search|SigE]) [Pubmed|7559346]
Open in new tab

[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]

2022-12-29 22:48:22

ghost

33

568fad8c4481a0ebbdd9419dce3b8a962fdf28bf

B9573F1C995908C67BA64482AC8EAAED4332739B

Biological materials
Mutant
BKE01530 (Δ[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCTTCCCCTCCCGCTT,  downstream forward: _UP4_TAATGGAGGGTTTTCTTGTG
BKK01530 (Δ[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCTTCCCCTCCCGCTT,  downstream forward: _UP4_TAATGGAGGGTTTTCTTGTG
References
12646705,10498740,7559346,14679227,16267290,22123250,24405365,35638784

B09FB626274B81F00A4FB42D188E089095343182

Page visits: 4019

Time of last update: 2023-02-05 03:18:20

Author of last update: Jstuelk