SubtiWiki SubtiWiki
acoA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

acoA
168

acetoin dehydrogenase E1 component (TPP-dependent alpha subunit)

locus
BSU_08060
Molecular weight
35.91 kDa
pI
4.91
Protein length
Gene length
function
acetoin utilization
product
acetoin dehydrogenase E1 component (TPP-dependent alpha subunit)
essential
no
synonyms
acoA, yfjK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1071

This gene is a member of the following regulons

Gene
Coordinates
879,002 → 880,003
The protein
Structure
[PDB|6CFO] (human PDH, E1, 38% identity) [pubmed|29970614]
Paralogous protein(s)
[protein|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA], [protein|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]
[wiki|Localization]
cytoplasm (homogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]
description
[pubmed|11274109]
regulation
induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]) [http://www.ncbi.nlm.nih.gov/sites/entrez/11274109 PubMed]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]-containing [wiki|RNA polymerase]) [ PubMed|11274109], in [regulon|protein:706864AAF36684AD5E46F30E9EB76315AB412700|acoR regulon]
[protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]: indirect positive regulation, in [regulon|protein:7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [PubMed|11274109], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
Open in new tab

[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]→[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]

2021-09-23 00:06:12

Bzhu

6

13d8d82e494fdc730b04ec27f52013adc2c6a3b0

0F3039221AB7F088A4D6093D7D4525D99014DE74

additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Mutant
MGNA-C280 (acoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2278 NBRP B. subtilis, Japan]
BKE08060 (Δ[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCGCCTCCTTCT,  downstream forward: _UP4_TATGAAAAAGGAGGAATGTA
BKK08060 (Δ[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCGCCTCCTTCT,  downstream forward: _UP4_TATGAAAAAGGAGGAATGTA
labs
[wiki|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
References
22900538,21815947,11274109,10368162,10666464,12884008,16479537,11274109,16428414,29970614,31113899

B0A333BDFAE816B48B856A1DD91B73C41584A8E4

Page visits: 3213

Time of last update: 2021-09-22 20:11:02

Author of last update: Jstuelk