acoA

acoA
168

acetoin dehydrogenase E1 component (TPP-dependent alpha subunit)

locus
BSU_08060
Molecular weight
35.91 kDa
pI
4.91
Protein length
Gene length
function
acetoin utilization
product
acetoin dehydrogenase E1 component (TPP-dependent alpha subunit)
essential
no
synonyms
acoA, yfjK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1071

This gene is a member of the following regulons

Gene
Coordinates
879,002 → 880,003
The protein
Structure
[PDB|6CFO] (human PDH, E1, 38% identity) [pubmed|29970614]
[AF|O31404]
Paralogous protein(s)
[protein|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA], [protein|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]
[wiki|Localization]
cytoplasm (homogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]
description
[pubmed|11274109]
regulation
induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]) [http://www.ncbi.nlm.nih.gov/sites/entrez/11274109 PubMed]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]-containing [wiki|RNA polymerase]) [ PubMed|11274109], in [regulon|protein:706864AAF36684AD5E46F30E9EB76315AB412700|acoR regulon]
[protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]: indirect positive regulation, in [regulon|protein:7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [PubMed|11274109], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
Open in new tab

[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]→[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]

2022-06-20 03:21:23

Bzhu

26

13d8d82e494fdc730b04ec27f52013adc2c6a3b0

0F3039221AB7F088A4D6093D7D4525D99014DE74

additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Mutant
MGNA-C280 (acoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2278 NBRP B. subtilis, Japan]
BKE08060 (Δ[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCGCCTCCTTCT,  downstream forward: _UP4_TATGAAAAAGGAGGAATGTA
BKK08060 (Δ[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCGCCTCCTTCT,  downstream forward: _UP4_TATGAAAAAGGAGGAATGTA
labs
[wiki|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
References
22900538,21815947,11274109,10368162,10666464,12884008,16479537,11274109,16428414,29970614,31113899

B0A333BDFAE816B48B856A1DD91B73C41584A8E4

Page visits: 3818

Time of last update: 2022-06-25 16:05:50

Author of last update: Jstuelk