yndE

yndE
168

part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF] germinant receptor of unknown specificity

locus
BSU_17760
Molecular weight
40.31 kDa
pI
9.09
Protein length
Gene length
function
germination
product
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF] germinant receptor
essential
no
synonyms
yndE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5902

This gene is a member of the following regulons

Gene
Coordinates
1,909,086 → 1,910,177
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
[wiki|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
Structure
[AF|O31809]
Paralogous protein(s)
[protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB], [protein|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB], [protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]
description
[Pubmed|16497325]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]→[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]

2022-12-29 23:37:33

ghost

43

2475fc3f605374c7d03f837ccdb4b7cf919dd1e9

8FEE9610941E29EE00A37E1F39BFC210F89F0F5C

Biological materials
Mutant
MGNA-A023 (yndE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/23 NBRP B. subtilis, Japan]
BKE17760 (Δ[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGACTTTATCACCATC,  downstream forward: _UP4_GTCATTTCGAAATGGAGGAA
BKK17760 (Δ[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGACTTTATCACCATC,  downstream forward: _UP4_GTCATTTCGAAATGGAGGAA
References
15699190,16497325,10762253

B14179D0EF5D3493E5CDB8E15378A5088B4FFD10

Page visits: 1647

Time of last update: 2023-02-04 15:29:02

Author of last update: Melvin.boenninger