

urease (beta subunit)

Molecular weight
13.50 kDa
Protein length
Gene length
utilization of urea as alternative nitrogen source
urease (beta subunit)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0832

This gene is a member of the following regulons

3,768,420 → 3,768,794
The protein
Catalyzed reaction/ biological activity
2 H+ + H2O + urea --> CO2 + 2 NH4+ (according to UniProt)
Protein family
urease beta subunit family (single member, according to UniProt)
[PDB|3UBP] (from B. pasteurii, 48% identity) [pubmed|10368287]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Open in new tab


2022-11-24 09:28:16





induced by nitrogen limitation ([protein|search|GlnR], [protein|search|TnrA]) [Pubmed|9287005]
regulatory mechanism
[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]: repression, [Pubmed|9287005], in [regulon|protein:641C4BDD9702804642E1753A9C779E80FABB3919|glnR regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|9287005], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]: activation, [Pubmed|12374841], in [regulon|protein:52C1601482C26400A524E880334BB801F832D6ED|pucR regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|9287005,12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9287005], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|9287005], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab


2022-11-23 04:19:25





Biological materials
BKE36650 (Δ[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCAATTTGAAATGCTCCCG,  downstream forward: _UP4_GGCTGGATGGAGGGTGTAAT
BKK36650 (Δ[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCAATTTGAAATGCTCCCG,  downstream forward: _UP4_GGCTGGATGGAGGGTGTAAT
Original Publications


Page visits: 1608

Time of last update: 2022-11-27 05:22:20

Author of last update: Melvin.boenninger