SubtiWiki SubtiWiki
phy

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

phy
168

phytase

locus
BSU_19800
Molecular weight
41.79 kDa
pI
4.94
Protein length
Gene length
function
utilization of inositol hexakisphosphate (phytate)
product
3-phytase
essential
no
ec
3.1.3.8
synonyms
phy, yodV, yzxA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4247

This gene is a member of the following regulons

Gene
Coordinates
2,150,108 → 2,151,256
The protein
Catalyzed reaction/ biological activity
1D-myo-inositol hexakisphosphate + H2O --> 1D-myo-inositol 1,2,4,5,6-pentakisphosphate + phosphate (according to UniProt)
[wiki|Domains]
BPP domain (aa 27-361) (according to UniProt)
Structure
[PDB|3AMR]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]
description
[Pubmed|7592393]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the gene is not expressed in 'B. subtilis' due to the absene of a functional promoter [PubMed|16980498]
Open in new tab

[gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]

2022-01-13 09:15:50

ghost

6

2621bca7f940dd8e2b0dbfbfa4013218b6a97ef4

9290704232A0E3CAC20CD325BE347C55A6D34578

Biological materials
Mutant
MGNA-B509 (yodV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1508 NBRP B. subtilis, Japan]
BKE19800 (Δ[gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTACCCTCCTCTTT,  downstream forward: _UP4_TAGAATAGAAAGCAGCTTGT
BKK19800 (Δ[gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTACCCTCCTCTTT,  downstream forward: _UP4_TAGAATAGAAAGCAGCTTGT
References
18957862,24407511,10655618,7592393,16980498,20601512,23178368,20817675,26106383

B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B

Page visits: 1550

Time of last update: 2022-01-17 10:19:56

Author of last update: Melvin.boenninger