yclH

yclH
168

similar to [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_03730
Molecular weight
25.06 kDa
pI
8.17
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yclH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1136

This gene is a member of the following regulons

Gene
Coordinates
424,208 → 424,888
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 4-226) (according to UniProt)
Structure
[PDB|1L2T] (from Methanocaldococcus jannaschii, 33% identity) [pubmed|12150914]
[AF|P94411]
Paralogous protein(s)
[protein|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]
[wiki|Localization]
membrane associated (via [protein|FFCC02FA996D570C69F79AAC22C2C4FCAD9E89D9|yclI]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|FFCC02FA996D570C69F79AAC22C2C4FCAD9E89D9|yclI]-[gene|B23CAC2563A36415C482AE2FA695E09228EF5B32|yclH]
description
[Pubmed|20512483]
regulatory mechanism
[protein|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]: activation, [Pubmed|20512483], in [regulon|protein:706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ regulon]
Open in new tab

[gene|FFCC02FA996D570C69F79AAC22C2C4FCAD9E89D9|yclI]→[gene|B23CAC2563A36415C482AE2FA695E09228EF5B32|yclH]

2022-11-16 01:55:29

ghost

14

a09e125240d7df4046342ef1f346a520d82a73a0

D4485460FDAF042DFDEA7C568E41511292EB4F3C

Biological materials
Mutant
MGNA-C005 (yclH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2003 NBRP B. subtilis, Japan]
BKE03730 (Δ[gene|B23CAC2563A36415C482AE2FA695E09228EF5B32|yclH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAAGCTCATAGGTTCCGCCT,  downstream forward: _UP4_TAACAAAACGCGCCTCTGCC
BKK03730 (Δ[gene|B23CAC2563A36415C482AE2FA695E09228EF5B32|yclH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAAGCTCATAGGTTCCGCCT,  downstream forward: _UP4_TAACAAAACGCGCCTCTGCC
References
10092453,20512483,12150914

B23CAC2563A36415C482AE2FA695E09228EF5B32

Page visits: 1167

Time of last update: 2022-11-27 11:25:45

Author of last update: Melvin.boenninger