SubtiWiki SubtiWiki
adhR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

adhR
168

transcriptional activator ([wiki|MerR family]) of [gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA], responsive to formaldehyde and methylglyoxal

locus
BSU_27000
Molecular weight
16.30 kDa
pI
9.64
Protein length
Gene length
function
regulation of the protective response to formaldehyde and methylglyoxal
product
transcriptional activator ([wiki|MerR family])
essential
no
synonyms
adhR, yraB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0789

This gene is a member of the following regulons

Gene
Coordinates
2,755,382 → 2,755,804
The protein
Protein family
[wiki|MerR family]
[wiki|Domains]
[wiki|HTH merR-type domain] (aa 1-69) (according to UniProt)
Structure
[PDB|3GP4] (from Listeria monocytogenes, 47% identity)
Modification
activity probably redox-controlled via thiol-(S)-alkylation at Cys-52 by aldehydes [Pubmed|19170879]
[wiki|Localization]
cytoplasmic
Expression and Regulation
Operons
genes
[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]
description
[pubmed|22383849]
Open in new tab

[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]

2021-09-18 05:53:36

Jstuelk

4

ab8ec599c1138a02b899f199cff4a4dc992bdedd

589DB7243018B9F813268BA1464CE1AC7D697083

Biological materials
Mutant
MGNA-A238 (yraB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/238 NBRP B. subtilis, Japan]
BKE27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT,  downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
BKK27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT,  downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
labs
[wiki|Haike Antelmann],University of Greifswald, Germany
References
21722790

B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD

Page visits: 834

Time of last update: 2021-09-18 05:53:28

Author of last update: Melvin.boenninger