ahpA

ahpA
168

alkyl hydroperoxide reductase

locus
BSU_14220
Molecular weight
20.30 kDa
pI
4.49
Protein length
Gene length
function
protection against peroxide stress
product
alkyl hydroperoxide reductase
essential
no
synonyms
ahpA, ykuU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0450

This gene is a member of the following regulons

Gene
Coordinates
1,492,261 → 1,492,803
The protein
Catalyzed reaction/ biological activity
[protein]-dithiol + hydroperoxide --> [protein]-disulfide + alcohol + H2O (according to UniProt)
Protein family
[wiki|peroxiredoxin family] (according to UniProt)
[wiki|Domains]
[wiki|Thioredoxin domain] (aa 4-165) (according to UniProt)
Structure
[PDB|4XCS] (human peroxiredoxin, 48% identity)
[AF|O34564]
Paralogous protein(s)
[protein|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]
Expression and Regulation
Operons
genes
[gene|B283B702D917E310130BC33A40BF6A5853C3D4C1|ahpA]-[gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|B283B702D917E310130BC33A40BF6A5853C3D4C1|ahpA]→[gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]

2022-03-13 19:21:58

ghost

12

db3a077f5db973f301f5c2b07584b017a7d043c3

86001A08BE15B429348F69EB0340A4C6602B0430

Biological materials
Mutant
GP1729 [gene|search|ahpAT]::kan trpC2 available at Jörg Stülkes lab
MGNA-B343 (ykuU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1342 NBRP B. subtilis, Japan]
BKE14220 (Δ[gene|B283B702D917E310130BC33A40BF6A5853C3D4C1|ahpA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCCCTCCAATTT,  downstream forward: _UP4_TAATTCTTTCCAAGAACGAA
BKK14220 (Δ[gene|B283B702D917E310130BC33A40BF6A5853C3D4C1|ahpA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTATCCCTCCAATTT,  downstream forward: _UP4_TAATTCTTTCCAAGAACGAA
References
20817675,26787766,27683249

B283B702D917E310130BC33A40BF6A5853C3D4C1

Page visits: 1369

Time of last update: 2022-06-22 22:31:20

Author of last update: Melvin.boenninger