ybfM

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

ybfM
168

similar to alkaline phosphatase

locus
BSU_02280
Molecular weight
18.20 kDa
pI
9.48
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybfM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0586

This gene is a member of the following regulons

Gene
Coordinates
248,268 → 248,756
The protein
Protein family
dedA family (with [protein|289828D37CF5422908316ED2EF1AEAE76F84161D|yngC] and [protein|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX], according to UniProt)
Structure
[AF|O31453]
Paralogous protein(s)
[protein|289828D37CF5422908316ED2EF1AEAE76F84161D|yngC]
[protein|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX], (30%)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]-[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]-[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]-[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]
description
[Pubmed|22383849,14762009]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|14762009], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|14762009], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]→[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]

2022-04-08 06:57:19

Jstuelk

20

9c5c2fcf642de63f240b8ac199efc5b5939a836b

2A09CF2D25D4B824D045D3A292B8FC9B5A167361

Biological materials
Mutant
BKE02280 (Δ[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTAATCCGCTATGAGCTGCT,  downstream forward: _UP4_ATCGGAAGGGTTATAGGGAT
BKK02280 (Δ[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTAATCCGCTATGAGCTGCT,  downstream forward: _UP4_ATCGGAAGGGTTATAGGGAT
References
14762009

B2C089DCE51CA0CB11947FCD6F4EFAFF66269829

Page visits: 1099

Time of last update: 2022-05-19 22:29:10

Author of last update: Melvin.boenninger