SubtiWiki SubtiWiki
yhdT

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yhdT
168

similar to magnesium exporter

locus
BSU_09590
Molecular weight
51.35 kDa
pI
4.75
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhdT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1253

This gene is a member of the following regulons

Gene
Coordinates
1,035,554 → 1,036,939
The protein
Protein family
[wiki|UPF0053 family] (according to UniProt)
[wiki|Domains]
[wiki|CNNM transmembrane domain] (aa 1-202) (according to UniProt)
[wiki|DUF21 domain] (7-202)
2 [wiki|CBS domain]s (aa 221-280, aa 290-347) (according to UniProt)
Structure
[PDB|4HG0] (CorC from E. coli, corresponds to the [wiki|CBS domain]s and the C-terminal transporter-associated domain)
Paralogous protein(s)
[protein|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA], [protein|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB], [protein|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA], [protein|A459410312A926365B45CEB4694DE399B38820A2|yugS]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|B2E9D026B668C8530C406353E3400059388566FB|yhdT]
description
[Pubmed|22383849]
Open in new tab

[gene|B2E9D026B668C8530C406353E3400059388566FB|yhdT]

2021-11-13 17:32:38

Jstuelk

13

9fc3909755d86d16768d8c922560d340f21e36a5

11325275FFD543252FC6389DA31A8671202407DB

Biological materials
Mutant
MGNA-A698 (yhdT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/698 NBRP B. subtilis, Japan]
BKE09590 (Δ[gene|B2E9D026B668C8530C406353E3400059388566FB|yhdT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTAACCCTATCCTCTCA,  downstream forward: _UP4_AGCGAGAAATAAGCTCAAGG
BKK09590 (Δ[gene|B2E9D026B668C8530C406353E3400059388566FB|yhdT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTAACCCTATCCTCTCA,  downstream forward: _UP4_AGCGAGAAATAAGCTCAAGG
Expression vectors
pGP2928 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3464 (215-351aa) (N-terminal 6xHis-tag, purification from E. coli, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3469 (215-351aa) (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
References
20525796,27120414,27933050,31415562

B2E9D026B668C8530C406353E3400059388566FB

Page visits: 1792

Time of last update: 2022-01-27 08:38:51

Author of last update: Jstuelk