ezrA

ezrA
168

negative regulator of [protein|search|FtsZ ]ring formation

locus
BSU_29610
Molecular weight
64.82 kDa
pI
4.76
Protein length
Gene length
function
control of [protein|search|FtsZ ]ring formation
product
[protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]-interacting protein, member of the [wiki|divisome]
essential
no
synonyms
ezrA, ytwP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4477

This gene is a member of the following regulons

Gene
Coordinates
3,029,729 → 3,031,417
Phenotypes of a mutant
altered localization of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] and [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1] [Pubmed|25403286]
growth defects, elongated cells [Pubmed|25403286]
the [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA] mutation is synthetically lethal with a [gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF] mutation [Pubmed|24218584]
a [gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA] double mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
[gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA] and [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA] mutations are synthetically lethal, this can be suppressed by a [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]-K86E mutant protein [pubmed|33737746]
depletion of ''[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]'' and deletion of ''[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' have a strong synthetic defect in [wiki|cell division] [Pubmed|24825009]
The protein
Catalyzed reaction/ biological activity
inhibits [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] polymerization [Pubmed|25403286]
recruits [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]]] to the division septum [Pubmed|25403286]
activates [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] [Pubmed|25845974]
Protein family
EzrA family (single member, according to UniProt)
Structure
[PDB|4UXV] (the 60 kDa cytoplasmic domain) [Pubmed|25403286]
[AF|O34894]
Effectors of protein activity
degradation of [protein|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA] involves [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH] [Pubmed|24222488]
[wiki|Localization]
cell membrane (integral) [Pubmed|10449747]
1 transmembrane domain at the N-terminus [Pubmed|25403286]
Expression and Regulation
Operons
genes
[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]
description
[Pubmed|9387221]
regulation
constitutively expressed [Pubmed|23701187]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15317798], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
degradation of [protein|search|EzrA] involves [protein|search|FtsH] [PubMed|24222488]
Open in new tab

[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]

2022-12-04 21:48:43

ghost

25

f3c1e0849cc17835d5e01c5c0e5588c9e673eaf4

9DFFF931CD66242A6C13173D3BB37BB5FBCF0488

Biological materials
Mutant
MGNA-A428 (ytwP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/428 NBRP B. subtilis, Japan]
1A805 ( ''ezrA''::''kan''), [Pubmed|15101985], available at [http://bgsc.org BGSC]
1A1279 (''ezrA''::''spec''), [Pubmed|10449747], available at [http://bgsc.org BGSC]
1A1280 (''ezrA-gfp''), [Pubmed|10449747], available at [http://bgsc.org BGSC]
BKE29610 (Δ[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGAGCCCCCTTGCTG,  downstream forward: _UP4_TAGATAATCACGACCATGAA
BKK29610 (Δ[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGAGCCCCCTTGCTG,  downstream forward: _UP4_TAGATAATCACGACCATGAA
References
Reviews
19680248,19884039,28357277,31405912
Original Publications
10449747,16420366,15317782,16549676,17662947,12368265,18363795,9387221,15317798,19429628,18763711,21401734,24222488,23701187,17718511,24218584,24097947,24825009,25068683,25403286,25845974,25954268,31287946

B317D7E51824DD70EF84E4D5D7290D601BF4FAB6

Page visits: 3658

Time of last update: 2022-12-06 03:31:14

Author of last update: Jstuelk