SubtiWiki SubtiWiki
coaA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

coaA
168

type I pantothenate kinase, major enzyme

locus
BSU_23760
Molecular weight
36.49 kDa
pI
5.89
Protein length
Gene length
function
biosynthesis of coenzyme A
product
pantothenate kinase
essential
no
ec
2.7.1.33
synonyms
coaA, yqjS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1072

This gene is a member of the following regulons

Gene
Coordinates
2,468,549 → 2,469,508
The protein
Catalyzed reaction/ biological activity
(R)-pantothenate + ATP --> (R)-4'-phosphopantothenate + ADP + H+ (according to UniProt)
Protein family
prokaryotic pantothenate kinase family (single member, according to UniProt)
Structure
[PDB|1SQ5] (from ''Escherichia coli'', 49% identity, 67% similarity) [Pubmed|15136582]
Expression and Regulation
Operons
genes
[gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]-[gene|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ]-[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]-[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]-[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]
description
[pubmed|22383849]
Open in new tab

[gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]→[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]

2022-01-15 03:18:07

Jstuelk

49

849135de1757b2b3b5c94019b4a82218149cb07b

7866C7C07985979A54369C1D59D36565C48D9B56

Biological materials
Mutant
MGNA-C399 (yqjS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2397 NBRP B. subtilis, Japan]
BKE23760 (Δ[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTACACCTGACTCT,  downstream forward: _UP4_GTGTTGGTAAGGAGGGTATG
BKK23760 (Δ[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTACACCTGACTCT,  downstream forward: _UP4_GTGTTGGTAAGGAGGGTATG
References
1328157,24784177

B3362449EF3C9D533090FBD7E7333A3CC5D902CB

Page visits: 1339

Time of last update: 2022-01-18 21:32:24

Author of last update: Melvin.boenninger