mdr

mdr
168

multidrug-efflux transporter (puromycin, nerfloxacin, tosufloxacin)

locus
BSU_03070
Molecular weight
46.65 kDa
pI
9.7
Protein length
Gene length
function
drug resistance
product
multidrug-efflux transporter (puromycin, nerfloxacin, tosufloxacin)
essential
no
synonyms
mdr, ycgD, bmr3

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
332,441 → 333,979
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|EmrB family] (according to UniProt)
Structure
[PDB|6OOM] (from E. coli, corresponds to aa 51 ... 412, 22% identity) [pubmed|31240248]
[AF|P96712]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
BKE03070 (Δ[gene|B36B4BE77A207C5B16876D8E656266C8BA650B76|mdr]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTCTACCTCCTCTT,  downstream forward: _UP4_TAACATAAAAAAAGCAGTAC
BKK03070 (Δ[gene|B36B4BE77A207C5B16876D8E656266C8BA650B76|mdr]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTCTACCTCCTCTT,  downstream forward: _UP4_TAACATAAAAAAAGCAGTAC
References
12850135,31240248

B36B4BE77A207C5B16876D8E656266C8BA650B76

Page visits: 1808

Time of last update: 2022-11-29 09:04:40

Author of last update: Jstuelk