ydfS

ydfS
168

unknown

locus
BSU_05540
Molecular weight
26.96 kDa
pI
8.45
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydfS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2323

This gene is a member of the following regulons

Gene
Coordinates
601,019 → 601,726
The protein
Protein family
[wiki|UPF0702 family] (according to UniProt)
Structure
[PDB|3C6F] ([protein|EBD0F966FD7B3662814D530064BD307561A5CB15|yetF], corresponds to aa 81 ... 230, 36% identity)
[AF|P96697]
Paralogous protein(s)
[protein|EBD0F966FD7B3662814D530064BD307561A5CB15|yetF]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|B37938C639FC87DAA72AA82998DA8DF25E63CF37|ydfS]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|B37938C639FC87DAA72AA82998DA8DF25E63CF37|ydfS]

2022-12-22 23:43:08

ghost

18

d02321d16138757bedf429b14c146381249382c2

A0298BD9AC48A4AA5768B327E935C706BAFCBE26

Biological materials
Mutant
MGNA-C156 (ydfS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2154 NBRP B. subtilis, Japan]
BKE05540 (Δ[gene|B37938C639FC87DAA72AA82998DA8DF25E63CF37|ydfS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTATGGCGCTCCCCGC,  downstream forward: _UP4_AAGGAATGAAGGAACAATCA
BKK05540 (Δ[gene|B37938C639FC87DAA72AA82998DA8DF25E63CF37|ydfS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTATGGCGCTCCCCGC,  downstream forward: _UP4_AAGGAATGAAGGAACAATCA
References
16497325,35638784

B37938C639FC87DAA72AA82998DA8DF25E63CF37

Page visits: 1265

Time of last update: 2023-02-05 15:32:12

Author of last update: Jstuelk