yqfL

yqfL
168

Modulator of [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN] activity, similar to phosphoenolpyruvate synthetase regulatory protein

locus
BSU_25240
Molecular weight
30.20 kDa
pI
5.78
Protein length
Gene length
function
inhibits [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN] activity
product
modulator of [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN] activity
essential
no
ec
2.7.-.-
synonyms
yqfL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1806

This gene is a member of the following regulons

Gene
Coordinates
2,604,121 → 2,604,933
The protein
Catalyzed reaction/ biological activity
negative effector of [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN] activity [Pubmed|15720552]
ADP + Nτ-phospho-L-histidyl/L-threonyl-[pyruvate, phosphate dikinase] --> AMP + H+ + Nτ-phospho-L-histidyl/O-phospho-L-threonyl-[pyruvate, phosphate dikinase] (according to UniProt)
H+ + Nτ-phospho-L-histidyl/O-phospho-L-threonyl-[pyruvate, phosphate dikinase] + phosphate --> diphosphate + Nτ-phospho-L-histidyl/L-threonyl-[pyruvate, phosphate dikinase] (according to UniProt)
Protein family
pyruvate, phosphate/water dikinase regulatory protein family (single member, according to UniProt)
[wiki|Domains]
nucleotide binding domain (ATP) (151–158)
Structure
[PDB|5D0N] (from maize, 39% identity) [pubmed|26620526]
[AF|P54470]
Expression and Regulation
Operons
genes
[gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]-[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]
description
[Pubmed|15720552]
regulation
constitutive [Pubmed|15720552]
additional information
the intracellular concentration of CcpN is about 4 myM (according to [PubMed|20408793]).
Open in new tab

[gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]→[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]

2022-12-05 10:55:29

ghost

34

3fe4ca7e20abf4f06c8caf7d6e2bf664f557186b

0E37F61E4E6EAE016A7E0E8F6D82E3B6339F8D91

Biological materials
Mutant
GP1677 (Δ[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]::aphA3 trpC2), available in [wiki|Jörg Stülke]'s lab
GP1678 (Δ([gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]-[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]::aphA3 trpC2), available in [wiki|Jörg Stülke]'s lab
MGNA-C492 (yqfL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2490 NBRP B. subtilis, Japan]
BKE25240 (Δ[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATCCCCCCGTTAGT,  downstream forward: _UP4_TAACTCAGGACGCTCTATCC
BKK25240 (Δ[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATCCCCCCGTTAGT,  downstream forward: _UP4_TAACTCAGGACGCTCTATCC
Expression vectors
pGP2197, expression with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
References
15720552,26620526,20044937

B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7

Page visits: 1849

Time of last update: 2022-12-05 15:35:54

Author of last update: Jstuelk