ykoV

ykoV
168

DNA-end-binding protein Ku, non-homologous end joining DNA repair

locus
BSU_13410
Molecular weight
34.91 kDa
pI
7.21
Protein length
Gene length
function
non-homologous end joining DNA repair, repair of gapped DNA substrates
product
DNA-end-binding protein Ku
essential
no
synonyms
ykoV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1273

This gene is a member of the following regulons

Gene
Coordinates
1,406,357 → 1,407,292
Phenotypes of a mutant
sensitivity to ionizing radiation in the stationary phase  [Pubmed|12215643]
sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]
a ''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]'' double mutant is sensitive to radiation [Pubmed|24123749]
reduced resistance towards electron beams [pubmed|31948638]
The protein
Catalyzed reaction/ biological activity
stimulation of [protein|127CB0930A2D96B18D9261180028818F158C68CB|ligD] non-homologous end-joining activity [Pubmed|23691176,26961308]
binds at the DNA double-strand breaks and recruits the ligase [protein|search|LigD ]to seal the break [pubmed|15778718,16518468]
Protein family
prokaryotic Ku family (single member, according to UniProt)
[wiki|Domains]
KU domain (aa 26-210) (according to UniProt)
Structure
[AF|O34859]
[wiki|Localization]
associates with the nucleoid during germination [Pubmed|16497325]
Expression and Regulation
Operons
genes
[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|16497325]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|16497325], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]→[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]

2022-12-11 20:12:35

ghost

21

7fcc8aee83f81918f6eb01c909915f020ead37c2

8BDE381CB52702FA257381283FE46A01B66ABB9F

Biological materials
Mutant
MGNA-A779 (ykoV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/779 NBRP B. subtilis, Japan]
BP809 (Δ[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]::''cat'') available in [wiki|Juan Alonso]'s and [wiki|Jörg Stülke]'s labs [pubmed|16780573]
BP141 (Δ''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [wiki|Fabian Commichau]'s and [wiki|Jörg Stülke]'s labs [pubmed|30863384]
BP142 (Δ''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]-[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [wiki|Fabian Commichau]'s lab
BKE13410 (Δ[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTAGTAACTTATGGG,  downstream forward: _UP4_AAAGCCTCCGGCACATCATA
BKK13410 (Δ[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTAGTAACTTATGGG,  downstream forward: _UP4_AAAGCCTCCGGCACATCATA
References
Reviews
11591342,11719239,17938628,22933559,30746801
Original Publications
16497325,11483577,23691176,12215643,17293412,24123749,25355514,26961308,15778718,16518468,29234047,30976810,31948638

B3E1652E9F3BDC9520847C479A2C0BED25025B4C

Page visits: 1836

Time of last update: 2023-02-07 09:21:27

Author of last update: Jstuelk