SubtiWiki SubtiWiki
mhqP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mhqP
168

may be involved in protection against methyl-hydroquinone

locus
BSU_05500
Molecular weight
13.14 kDa
pI
8.62
Protein length
Gene length
function
may be involved in protection against methyl-hydroquinone
product
unknown
essential
no
synonyms
mhqP, ydfP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2259

This gene is a member of the following regulons

Gene
Coordinates
598,154 → 598,543
The protein
Protein family
DoxX family (with [protein|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD], according to UniProt)
Expression and Regulation
Operons
genes
[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]
description
[Pubmed|11532142]
regulation
induced by catechol and 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
regulatory mechanism
[protein|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]: repression, [Pubmed|17725564], in [regulon|protein:997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725564], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11532142], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]→[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]

2022-01-14 23:21:46

ghost

6

350f9b3ed02297ae036a32ec03d768065ada6429

053E4E4A5A051804E8D607DA170A4E2E3F97B1D0

genes
[gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]-[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]
description
[Pubmed|17725564]
regulation
induced by catechol and 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
regulatory mechanism
[protein|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]: repression, [Pubmed|17725564], in [regulon|protein:997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725564], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]→[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]

2022-01-04 21:16:01

ghost

12

861c2755cb55e0bfdad6bb1ace7ebeb4dc8b648a

4CB4BE4DEF7D53B85280E482DDD12220874522FA

Biological materials
Mutant
MGNA-C169 (ydfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2167 NBRP B. subtilis, Japan]
BKE05500 (Δ[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCTCTCCTCATC,  downstream forward: _UP4_TAATACGAAAGTATGTAAGA
BKK05500 (Δ[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCTCTCCTCATC,  downstream forward: _UP4_TAATACGAAAGTATGTAAGA
References
17407181,17725564,11532142,27965289

B4384C8C0874BAA7822E9B6DCAB57790018271D8

Page visits: 1350

Time of last update: 2022-01-17 22:09:39

Author of last update: Melvin.boenninger