stage V sporulation germinant protein, essential for the transport of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2 )

Molecular weight
22.00 kDa
Protein length
Gene length
spore germination
stage V sporulation germinant protein

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5838

This gene is a member of the following regulons

2,439,804 → 2,440,415
Phenotypes of a mutant
delayed germination with germinant receptor-dependent germinants [Pubmed|24682327]
The protein
outer surface of the spore's inner membrane [Pubmed|35322191,24682327]
Expression and Regulation
expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG], [wiki|SpoVT]) [Pubmed|15699190,1903432,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2022-12-03 09:54:38





Biological materials
BKE23401 (Δ[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23401 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTGCGTTTTGTCGTCATGT,  downstream forward: _UP4_TTTATTTTAGAAAGGAGCGG
BKK23401 (Δ[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23401 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTGCGTTTTGTCGTCATGT,  downstream forward: _UP4_TTTATTTTAGAAAGGAGCGG
[wiki|Peter Setlow], University of Connecticut Health Center, USA
Original Publications


Page visits: 1596

Time of last update: 2022-12-04 10:39:37

Author of last update: Jstuelk