ytoI

ytoI
168

similar to transcriptional regulator ([wiki|GntR family])

locus
BSU_29270
Molecular weight
48.87 kDa
pI
6.59
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ytoI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4109

This gene is a member of the following regulons

Gene
Coordinates
2,997,301 → 2,998,620
Phenotypes of a mutant
an ''ytoI'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
The protein
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
2 [wiki|CBS domain]s (aa 195-254, aa 256-314) (according to UniProt)
Structure
[AF|O34921]
Expression and Regulation
Operons
genes
[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]
description
[Pubmed|9387221]
additional information
An [wiki|ncRNA] is predicted for'[protein|search|ytoI]' [PubMed|20525796]
Open in new tab

[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]

2022-12-01 04:50:00

ghost

26

123fdf57b313ace2ec7afdaaf309a23803e21280

37BEE6BD09E56AD5B14DED52E35B52F6D28EF21C

Biological materials
Mutant
MGNA-A152 (ytoI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/152 NBRP B. subtilis, Japan]
GP2213 (''[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]''::''aphA3''), available in [wiki|Jörg Stülke]'s lab
GP2214 (''[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]''::''phleo''), available in [wiki|Jörg Stülke]'s lab
BKE29270 (Δ[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGCCTTTCACCTCTAAGG,  downstream forward: _UP4_AGCTAAGGGACGTTCAGGCG
BKK29270 (Δ[gene|B4909B417F11C393A693488E07CC96B405FB1CE0|ytoI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGCCTTTCACCTCTAAGG,  downstream forward: _UP4_AGCTAAGGGACGTTCAGGCG
Expression vectors
pGP2933 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
References
16479537,9387221,20525796,23504016,26296725,31685546

B4909B417F11C393A693488E07CC96B405FB1CE0

Page visits: 2047

Time of last update: 2022-12-04 03:15:00

Author of last update: Jstuelk