yfkF
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

yfkF
168

similar to multidrug-efflux transporter

locus
BSU_07910
Molecular weight
42.53 kDa
pI
8.91
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfkF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
863,862 → 865,037
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[PDB|3WDO] (from E. coli, corresponds to aa 233 ... 344, 26% identity) [pubmed|23950222]
[AF|O34929]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|59E6468FD891F5271F38543515867B0B4625768D|prfA]-[gene|CF959D90A9B8F83E40E7B81CBFB00B5EC09EC0DD|prmC]-[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]
description
[Pubmed|22383849]
Open in new tab

[gene|59E6468FD891F5271F38543515867B0B4625768D|prfA]→[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]

2022-07-07 12:19:37

Jstuelk

20

f772f0238446923017cee65af9531adee8a533a8

11DDE5360DD627DCA1CFE914B4C14C3186501BC4

genes
[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]
description
[Pubmed|22383849]
Open in new tab

[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]

2022-07-28 16:12:21

Jstuelk

8

21ff1b6026dcab48e43ff3013d413b73545c1dbf

2FFF62107C95E4C48D510E1673E93F0C4CDFEC71

Biological materials
Mutant
MGNA-C347 (yfkF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2345 NBRP B. subtilis, Japan]
BKE07910 (Δ[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTGTCAGTTCTCCTTA,  downstream forward: _UP4_TAATCAAAAAGCCTCCCGAC
BKK07910 (Δ[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTGTCAGTTCTCCTTA,  downstream forward: _UP4_TAATCAAAAAGCCTCCCGAC
References
26528249,23950222

B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D

Page visits: 1649

Time of last update: 2022-08-17 14:10:11

Author of last update: Jstuelk