SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


similar to multidrug-efflux transporter

Molecular weight
42.53 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

863,862 → 865,037
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[PDB|3WDO] (from E. coli, corresponds to aa 233 ... 344, 26% identity) [pubmed|23950222]
cell membrane (according to UniProt)
Expression and Regulation
Open in new tab


2021-12-16 08:02:47





Open in new tab


2021-11-15 19:31:55





Biological materials
MGNA-C347 (yfkF::erm), available at the [ NBRP B. subtilis, Japan]
BKE07910 (Δ[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTGTCAGTTCTCCTTA,  downstream forward: _UP4_TAATCAAAAAGCCTCCCGAC
BKK07910 (Δ[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTGTCAGTTCTCCTTA,  downstream forward: _UP4_TAATCAAAAAGCCTCCCGAC


Page visits: 1484

Time of last update: 2022-01-17 18:53:06

Author of last update: Jstuelk