thiG

thiG
168

hydroxyethylthiazole phosphate biosynthesis

locus
BSU_11690
Molecular weight
26.87 kDa
pI
4.72
Protein length
Gene length
function
biosynthesis of thiamine
product
thiamin thiazole synthase
essential
no
ec
null
synonyms
thiG, yjbT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2022

This gene is a member of the following regulons

Gene
Coordinates
1,245,041 → 1,245,811
The protein
Catalyzed reaction/ biological activity
1-deoxy-D-xylulose 5-phosphate + 2-iminoacetate + [sulfur-carrier protein ThiS]-C-terminal Gly-NH-CH2-C(O)SH --> 2-[(2R,5Z)-2-carboxy-4-methylthiazol-5(2H)-ylidene]ethyl phosphate + [sulfur-carrier protein ThiS]-C-terminal Gly-Gly + 2 H+ + 2 H2O (according to UniProt)
Protein family
ThiG family (single member, according to UniProt)
Structure
[PDB|1XM3], [PDB|1TYG] (complex with [protein|95DA3F899037140F48B99E065C768356CE08FA94|thiS]) [Pubmed|15362849]
[AF|O31618]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705], [Pubmed|17726680]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
description
[Pubmed|1898926]
regulation
repressed by thiamine ([wiki|Thi-box]) [Pubmed|16356850]
the [wiki|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [wiki|RNA switch], via [wiki|RNA switch], in [regulon|protein:E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
Open in new tab

[gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]→[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]

2022-11-24 21:30:20

Jstuelk

28

a48634f4963321f6f5f59c5107f472325227a1b0

A1FEA45B91FD65F137EB4D1A0FCD88BC91331EAF

Biological materials
Mutant
MGNA-B165 (yjbT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1164 NBRP B. subtilis, Japan]
BKE11690 (Δ[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCTCATCCGCCTCCTACAAA,  downstream forward: _UP4_GTATGACAGGCAGGTATTCA
BKK11690 (Δ[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCTCATCCGCCTCCTACAAA,  downstream forward: _UP4_GTATGACAGGCAGGTATTCA
References
Reviews
19348578,10382260
Original Publications
15362849,17726680,16493705,19216519,14567704

B58B8F260E446E28BC2E3A9AA84EA771EC0A8634

Page visits: 1305

Time of last update: 2022-11-26 11:27:27

Author of last update: Melvin.boenninger