mutY

mutY
168

A/G-specific adenine glycosylase, part of the error prevention oxidized guanine system (with [protein|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM] and [protein|50A50E33796EEF8046142EE928753C355EF42A1A|rppH]), releases adenines from 8-oxo-G:A mismatches

locus
BSU_08630
Molecular weight
41.81 kDa
pI
6.04
Protein length
Gene length
function
DNA repair
product
A/G-specific adenine glycosylase
essential
no
ec
3.2.2.-
synonyms
mutY, yfhQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1194

This gene is a member of the following regulons

Gene
Coordinates
935,656 → 936,765
Phenotypes of a mutant
strongly reduced stationary phase mutagenesis [Pubmed|27399782]
increased susceptibility to Cr(VI) due to the accumulation of oxidative DNA damage [Pubmed|24973075]
The protein
Catalyzed reaction/ biological activity
releases adenines from 8-oxo-G:A mismatches
Hydrolyzes free adenine bases from 7,8-dihydro-8-oxoguanine:adenine mismatched double-stranded DNA, leaving an apurinic site (according to UniProt)
Protein family
Nth/MutY family (with [protein|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth], according to UniProt)
[wiki|Domains]
HhH domain (aa 108-137) (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
Structure
[PDB|1RRS] (complex with DNA, Geobacillus stearothermophilus)
[AF|O31584]
Expression and Regulation
Operons
genes
[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]-[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]
description
[Pubmed|10463184]
regulation
expression is constitutive throughout growth [Pubmed|20971907]
regulatory mechanism
[protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]: repression, in [regulon|protein:BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10463184], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|1900507], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]→[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]

2022-11-26 06:07:12

ghost

42

3a7a008cdfb01ec3e3352da847749371e7eede7c

C3DBF827F212448AA1AC6115B8D2A94E11E4693A

Biological materials
Mutant
MGNA-C322 (yfhQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2320 NBRP B. subtilis, Japan]
BKE08630 (Δ[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTGTTTCTCCCCAGT,  downstream forward: _UP4_ATCTCGGCTGCTCCGTAAAC
BKK08630 (Δ[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTGTTTCTCCCCAGT,  downstream forward: _UP4_ATCTCGGCTGCTCCGTAAAC
References
Reviews
22933559
Original Publications
10463184,19011023,20971907,24973075,25326311,25995449,27399782,30691388,33510358

B62083CF18FC4C796D95B960CF62FA963FC26CDE

Page visits: 2568

Time of last update: 2022-11-28 00:18:27

Author of last update: Jstuelk