SubtiWiki SubtiWiki
liaI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

liaI
168

resistance against oxidative stress and cell wall antibiotics, membrane anchor for [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH], secondary bacitracin resistance determinant

locus
BSU_33130
Molecular weight
13.24 kDa
pI
9.3
Protein length
Gene length
function
resistance against oxidative stress and cell wall antibiotics
product
membrane anchor for [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]
essential
no
synonyms
liaI, yvqI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,398,550 → 3,398,930
The protein
[wiki|Localization]
cell membrane [Pubmed|24666271]
forms highly dynamic membrane-associated foci under non-inducing conditions [Pubmed|24666271]
co-localizes with [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH] in distinct static spots at the cytoplasma membrane under stress conditions [Pubmed|24666271]
Expression and Regulation
Operons
genes
[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]
description
[Pubmed|20639339]
regulation
induced by bacitracin and rhamnolipids, induction requires high bacitracin concentrations ([protein|search|LiaR]) [Pubmed|16816187,22092710,26815905]
regulatory mechanism
[protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]: activation, [Pubmed|16816187], in [regulon|protein:49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15273097], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]→[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]

2021-10-31 07:10:38

ghost

7

4515f9113aa08a654b32efa8559976dff13218b4

88031D8530F9F98EF75C918C1D47EDBCF9DEBB70

genes
[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
description
[Pubmed|14651641]
regulation
''[protein|search|liaG]'': constitutive
Open in new tab

[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]→[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]

2021-11-02 15:17:31

ghost

11

844f52131490c84c9a0558a221a24520579ef3fd

F37C9323D2117C9590CDC8EC3E6B0E3F58AFC1F7

Biological materials
Mutant
MGNA-B040 (yvqI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1039 NBRP B. subtilis, Japan]
1A980 ( ''liaI''::''erm''), [Pubmed|15273097], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A980&Search=1A980 BGSC]
BKE33130 (Δ[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATCCTCCTTTCGT,  downstream forward: _UP4_TAATATCAATATATTAGGAG
BKK33130 (Δ[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATCCTCCTTTCGT,  downstream forward: _UP4_TAATATCAATATATTAGGAG
References
Reviews
27344142
Original Publications
19164152,15273097,17660417,17600057,20057163,16816187,15101989,17660417,12850135,16816187,20639339,20817675,22092710,24666271,26815905,30848888

B6D1159454969D1D578E05D5CE2259E079688510

Page visits: 2956

Time of last update: 2022-01-10 02:12:04

Author of last update: Jstuelk