

general stress protein, similar to glucose 1-dehydrogenase, survival of ethanol stress and low temperatures

Molecular weight
27.62 kDa
Protein length
Gene length
survival of ethanol stress and low temperatures

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

305,658 → 306,434
The protein
Catalyzed reaction/ biological activity
Beta-D-glucose + NAD(P)+ --> D-glucono-1,5-lactone + NAD(P)H (according to UniProt)
Beta-D-glucose + NAD+ --> D-glucono-1,5-lactone + NADH (according to UniProt)
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
[PDB|1GEE] (from ''Bacillus megaterium'', 56% identity)
Paralogous protein(s)
[protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|yxbG], [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC], [protein|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI], [protein|439B468A13137000FB42E9389391CB4986FFED84|fabG], [protein|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|yoxD]
[protein|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh], (53%)
[protein|CE990D33A12C50D22506A52E0099F7D97A762D4E|fadH], (31.9%)
[protein|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF], (34.3%)
[protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|kduD], (34.3%)
[protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD], (69%)
[protein|4DEFC2998464BF8327578C36A13A10DD277F991E|ykvO], (31,9%)
[protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|yhxC], (32,4%),
[protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|yhxD], (31,1%)
[protein|5964B6E817260DA7937796DDFA753A665A04D650|fabL], (31.6%)
Expression and Regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528,11544224]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab


2022-11-29 22:12:14





Biological materials
MGNA-C046 (ycdF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2044 NBRP B. subtilis, Japan]
BKE02830 (Δ[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTTGATATCCTCCTCT,  downstream forward: _UP4_TAGAAGACAAAACAGGGGGA
BKK02830 (Δ[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTTGATATCCTCCTCT,  downstream forward: _UP4_TAGAAGACAAAACAGGGGGA


Page visits: 1735

Time of last update: 2022-12-02 04:25:55

Author of last update: Melvin.boenninger