yebG

yebG
168

unknown

locus
BSU_06410
Molecular weight
7.43 kDa
pI
9.48
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yebG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
698,092 → 698,289
The protein
Structure
[AF|O34700]
Expression and Regulation
Operons
genes
[gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]-[gene|B7348FDC2690B0A7E17A7ED10FB7CC5C55E15707|yebG]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]->[gene|B7348FDC2690B0A7E17A7ED10FB7CC5C55E15707|yebG]

2022-09-25 22:44:34

Bzhu

29

1a56e9bd3297fe55f96af95dedd562665880725c

0B7C6C61957430C0B9B5BDD0AD0501F2AC17A463

Biological materials
Mutant
BKE06410 (Δ[gene|B7348FDC2690B0A7E17A7ED10FB7CC5C55E15707|yebG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTCTTTAATTCTCCT,  downstream forward: _UP4_TAAAACACGAACATTAGTAG
BKK06410 (Δ[gene|B7348FDC2690B0A7E17A7ED10FB7CC5C55E15707|yebG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTCTTTAATTCTCCT,  downstream forward: _UP4_TAAAACACGAACATTAGTAG
References
26577401

B7348FDC2690B0A7E17A7ED10FB7CC5C55E15707

Page visits: 793

Time of last update: 2022-09-27 11:47:43

Author of last update: Bzhu