yccK

yccK
168

similar to aldo/ ketoreductase

locus
BSU_02770
Molecular weight
34.65 kDa
pI
5.01
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yccK, yzaE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0667

This gene is a member of the following regulons

Gene
Coordinates
298,466 → 299,398
The protein
Protein family
[wiki|Aldo/keto reductase family] (according to UniProt)
[wiki|Aldo/keto reductase 2 subfamily] (according to UniProt)
Structure
[PDB|1PZ0] ([protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS], 53% identity) [Pubmed|15019785]
[AF|P46905]
Paralogous protein(s)
[protein|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS], [protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|yhdN]
[protein|35E890DE5096DF603FC16EF5F2CDF329CE104690|yrpG], (31,4%)
Expression and Regulation
Operons
genes
[gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]
description
[Pubmed|17322186]
Open in new tab

[gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]

2022-11-22 22:35:38

ghost

22

fa30fb763210d7511047e1b640d4c5a455d34eb6

C45DCAD492DBC0D6893FA2AE7F051AA57031B97E

Biological materials
Mutant
MGNA-B977 (yccK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1976 NBRP B. subtilis, Japan]
BKE02770 (Δ[gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCCTTCTCCTTTGA,  downstream forward: _UP4_TAAAAAAGGAAATAGCCGTC
BKK02770 (Δ[gene|B73D729097C00BE6F3C7FF1708738783EE93C6FB|yccK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCCTTCTCCTTTGA,  downstream forward: _UP4_TAAAAAAGGAAATAGCCGTC
References
17322186

B73D729097C00BE6F3C7FF1708738783EE93C6FB

Page visits: 962

Time of last update: 2022-11-26 09:46:55

Author of last update: Melvin.boenninger