ybbJ

ybbJ
168

unknown

locus
BSU_01710
Molecular weight
15.70 kDa
pI
9.91
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybbJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
193,075 → 193,557
The protein
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 5-160) (according to UniProt)
Structure
[AF|Q45583]
Biological materials
Mutant
BKE01710 (Δ[gene|B76F97C45CCCA0306D0ED0BF38156C2D6637C9E2|ybbJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTCTTGAGTCATGGGGTGGC,  downstream forward: _UP4_TAGTCTTAAGTGAAATAAAA
BKK01710 (Δ[gene|B76F97C45CCCA0306D0ED0BF38156C2D6637C9E2|ybbJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTCTTGAGTCATGGGGTGGC,  downstream forward: _UP4_TAGTCTTAAGTGAAATAAAA

B76F97C45CCCA0306D0ED0BF38156C2D6637C9E2

Page visits: 1050

Time of last update: 2022-11-26 03:17:16

Author of last update: Melvin.boenninger