SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


trigger enzyme, hypoxanthine phosphoribosyltransferase and part of a transcription activator

Molecular weight
20.10 kDa
Protein length
Gene length
purine salvage and interconversion, control of [gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH] expression
hypoxanthine phosphoribosyltransferase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0634

This gene is a member of the following regulons

76,344 → 76,886
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
diphosphate + IMP --> 5-phospho-α-D-ribose 1-diphosphate + hypoxanthine (according to UniProt)
diphosphate + GMP --> 5-phospho-α-D-ribose 1-diphosphate + guanine (according to UniProt)
Protein family
[wiki|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
[PDB|6D9Q] (apo-protein) [pubmed|31552824]
[PDB|6D9R] (complex with the substrate PRPP) [pubmed|31552824]
[PDB|6D9S] (complex with ppGpp) [pubmed|31552824]
Effectors of protein activity
inhibition of enzymatic activity by (p)ppGpp during the ´stringent response´, (p)ppGpp binds to the acive site of the enzyme and prevents the conversion of the apo-tetramer to the active dimer [Pubmed|31552824,22981860]
Kinetic information
KM (PRPP):  166 µM [pubmed|31552824]
KI (pppGpp): 1.7 µM [pubmed|31552824]
cytoplasm (according to UniProt)
Expression and Regulation
induced by heat shock (class III)
regulatory mechanism
[protein|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS]: activation, with [protein|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT] [Pubmed|24001521], in [regulon|protein:473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS regulon]
[protein|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]: activation, with [protein|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS] [Pubmed|24001521], in [regulon|protein:B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7608085], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is very stable (half-life > 15 min) [ PubMed]
Open in new tab


2022-01-25 15:37:47





expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]) [Pubmed|16497325]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab


2022-01-25 11:33:32





Biological materials
BKE00680 (Δ[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGATTTTGCTTGCCC,  downstream forward: _UP4_TGATCGGCAGCCTGCTTCCG
BKK00680 (Δ[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGATTTTGCTTGCCC,  downstream forward: _UP4_TGATCGGCAGCCTGCTTCCG
Original Publications


Page visits: 2804

Time of last update: 2022-01-27 15:38:47

Author of last update: Jstuelk