yfkR

yfkR
168

part of the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT] germinant receptor of unknown specificity

locus
BSU_07780
Molecular weight
42.64 kDa
pI
9.66
Protein length
Gene length
function
germination
product
part of the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT] germinant receptor
essential
no
synonyms
yfkR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5903

This gene is a member of the following regulons

Gene
Coordinates
847,498 → 848,652
The protein
Protein family
[wiki|GerABKC lipoprotein family] (according to UniProt)
Structure
[AF|O35028]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[gene|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[gene|AA76BEF6A4CECB5D3910918E8D91D8B919EDEA7E|yfkS]-[gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] in the forespore [Pubmed|15699190]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]→[gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]

2023-01-03 13:21:53

ghost

43

dda636dad622bad6868e738ae38525bc698bc72c

666F97F8C688D10436B55A68B5DECBC89AB10ED5

Biological materials
Mutant
MGNA-C258 (yfkR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2256 NBRP B. subtilis, Japan]
BKE07780 (Δ[gene|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACAAATGAGAAGCGGCAAAA,  downstream forward: _UP4_AGCCATTAATGGAGGTGCGT
BKK07780 (Δ[gene|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACAAATGAGAAGCGGCAAAA,  downstream forward: _UP4_AGCCATTAATGGAGGTGCGT
References
15699190,22383849,10762253

B7EEC1910715507596734540D24B3C93B4B7065F

Page visits: 1351

Time of last update: 2023-02-06 15:46:55

Author of last update: Melvin.boenninger