ydzO

ydzO
168

unknown

locus
BSU_05329
Molecular weight
7.30 kDa
pI
9.601
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
ydzO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
579,047 → 579,232
The protein
Structure
[AF|C0H3V9]
Expression and Regulation
Operons
genes
[gene|6CF44499017A78B8C43D68259F52056BCCB3EB8A|ydeS]-[gene|B836B265FCC3FBD0BA5DCAC534A72E902C9D45EE|ydzO]
description
[pubmed|22383849]
Open in new tab

[gene|6CF44499017A78B8C43D68259F52056BCCB3EB8A|ydeS]->[gene|B836B265FCC3FBD0BA5DCAC534A72E902C9D45EE|ydzO]

2022-05-17 16:38:59

Jstuelk

4

5b99c0b1f45ae065f1d7c6fb2e31cb640f3d1a33

D5EC9E48690CC2405E7282D8864F8AB424C177C0

Biological materials
Mutant
BKE05329 (Δ[gene|B836B265FCC3FBD0BA5DCAC534A72E902C9D45EE|ydzO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05329 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCGATAAGAGAACTTTT,  downstream forward: _UP4_TAAACAGGCCTCTAAAGAGA
BKK05329 (Δ[gene|B836B265FCC3FBD0BA5DCAC534A72E902C9D45EE|ydzO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05329 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCGATAAGAGAACTTTT,  downstream forward: _UP4_TAAACAGGCCTCTAAAGAGA

B836B265FCC3FBD0BA5DCAC534A72E902C9D45EE

Page visits: 647

Time of last update: 2022-06-20 18:48:54

Author of last update: Bzhu