SubtiWiki SubtiWiki
dhbE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

dhbE
168

2,3-dihydroxybenzoate-AMP ligase (enterobactin synthetase component E)

locus
BSU_31980
Molecular weight
59.76 kDa
pI
5.68
Protein length
Gene length
function
biosynthesis of the siderophore bacillibactin
product
2,3-dihydroxybenzoate-AMP ligase (enterobactin synthetase component E)
essential
no
synonyms
dhbE, entE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1021

This gene is a member of the following regulons

Gene
Coordinates
3,288,641 → 3,290,260
The protein
Protein family
[wiki|ATP-dependent AMP-binding enzyme family] (according to UniProt)
Structure
[PDB|1MDB] (complex with DHB-adenylate),  [PDB|1MDF]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]-[gene|DD647083C2E6968AD26A41C9F4EFBA942D75207C|ybdZ]
description
[Pubmed|8921902]
regulation
induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre]: repression, in [regulon|protein:65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8550523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [pubmed|29914988], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
additional information
the ''[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]'' operon is strongly unregulated in a ''[wiki|kre]'' mutant [Pubmed|26110430]
Open in new tab

[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]→[gene|DD647083C2E6968AD26A41C9F4EFBA942D75207C|ybdZ]

2021-12-30 15:24:18

Jstuelk

13

875cbc1c026244834e2efbc1140499985c0ab89d

CCA159D50C58E2078C51F543EDA686D77F6612EE

Biological materials
Mutant
BKE31980 (Δ[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTATCCCTCCAGCA,  downstream forward: _UP4_TAAAACAACAATTTGAGAGG
BKK31980 (Δ[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTATCCCTCCAGCA,  downstream forward: _UP4_TAAAACAACAATTTGAGAGG
labs
[wiki|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
References
12221282,11112781,11790741,12354229,8921902,8550523,20817675,21815947,24223955,26110430,29133393,29914988

B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5

Page visits: 2183

Time of last update: 2022-01-18 18:16:20

Author of last update: Jstuelk