splB

splB
168

spore photoproduct lyase, radical SAM enzyme

locus
BSU_13930
Molecular weight
39.79 kDa
pI
8.52
Protein length
Gene length
function
protection of spore DNA against photodamage
product
spore photoproduct lyase
essential
no
synonyms
splB, spl

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1533

This gene is a member of the following regulons

Gene
Coordinates
1,461,770 → 1,462,798
Phenotypes of a mutant
sensitive to blue light-induced DNA damage [pubmed|30054368]
The protein
Catalyzed reaction/ biological activity
repairs a special thymine dimer (5-thyminyl-5,6-dihydrothymine), which is commonly called spore photoproduct at the early germination phase
(5R)-5,6-dihydro-5-(thymidin-7-yl)thymidine in DNA --> thymidine dimer in DNA (according to UniProt)
Protein family
[wiki|Radical SAM superfamily] (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
uses the [4Fe-4S] cluster to reduce SAM
Structure
[PDB|4FHC] (SplB from ''Geobacillus thermodenitrificans'', 72% identity, 90% similarity) [Pubmed|22761404]
[AF|P37956]
Expression and Regulation
Operons
genes
[gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]-[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]
description
[Pubmed|8021181]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
regulatory mechanism
[protein|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]: negative autoregulation, in [regulon|protein:8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,8021181], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]→[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]

2022-12-13 12:54:09

ghost

17

05c0d6ddc5311aaa4612ef8b425cad6eec3b8cd4

ADCA4EE37BF8E4BFD653F8A03FBE5F3F554C5DF8

Biological materials
Mutant
BP130 (Δ''splB''::''spc''), available in [wiki|Fabian Commichau]'s and [wiki|Jörg Stülke]'s labs [pubmed|30054368]
BKE13930 (Δ[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACATCCTTTTC,  downstream forward: _UP4_TTCACTTAAACGGGCTGTTG
BKK13930 (Δ[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACATCCTTTTC,  downstream forward: _UP4_TTCACTTAAACGGGCTGTTG
References
Reviews
23164663,25477522,22197590,26265564,28027411
Original Publications
15699190,8021181,21671623,22197590,23607538,23799365,22761404,16829676,11470912,22906093,16829680,11902862,9733691,28401144,30054368
Structure of the spore photoproduct lesion in DNA
24598744

B873AE29ACAA0714D5F2E8648449B3280353C8AA

Page visits: 1283

Time of last update: 2023-02-06 09:11:24

Author of last update: Jstuelk