SubtiWiki SubtiWiki
ytjA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ytjA
168

hemolysin

locus
BSU_30680
Molecular weight
8.36 kDa
pI
10.27
Protein length
Gene length
function
hemolysis
product
hemolysin
essential
no
ec
null
synonyms
ytjA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0759

This gene is a member of the following regulons

Gene
Coordinates
3,138,097 → 3,138,324
The protein
Protein family
UPF0161 family (single member, according to UniProt)
Biological materials
Mutant
MGNA-A294 (ytjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/294 NBRP B. subtilis, Japan]
BKE30680 (Δ[gene|B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7|ytjA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCAGCAACCTT,  downstream forward: _UP4_GTTCCTGAAAAGAAACAAAA
BKK30680 (Δ[gene|B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7|ytjA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTTCAGCAACCTT,  downstream forward: _UP4_GTTCCTGAAAAGAAACAAAA
References
19306042,19306042

B8E694FD61BAC3776E6CA1F38214CCD254D2F4B7

Page visits: 827

Time of last update: 2022-01-20 16:27:32

Author of last update: Melvin.boenninger