gbsB
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

gbsB
168

choline dehydrogenase (FAD-dependent), glycine betaine synthesis

locus
BSU_31050
Molecular weight
43.39 kDa
pI
4.91
Protein length
Gene length
function
osmoprotection
product
choline dehydrogenase (FAD-dependent)
essential
no
ec
1.1.1.1
synonyms
gbsB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1454

This gene is a member of the following regulons

Gene
Coordinates
3,183,867 → 3,185,075
The protein
Catalyzed reaction/ biological activity
choline + NAD+ --> betaine aldehyde + H+ + NADH (according to UniProt)
Protein family
iron-containing alcohol dehydrogenase family (with [protein|1E951C2B640966643D5F081159522CD1C51942C8|yugJ] and [protein|D81610C7CA2A92FCB1195591ACB613E7C1288F6B|yugK], according to UniProt)
[wiki|Cofactors]
FAD
Structure
[PDB|3BFJ] (from Klebsiella pneumoniae, 39% identity) [pubmed|19011020]
[AF|P71017]
Expression and Regulation
Operons
genes
[gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]
description
[Pubmed|8752328]
regulation
induced by choline ([protein|search|GbsR]) [Pubmed|22408163,8752328]
regulatory mechanism
[protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]: repression, (transcriptional roadblock) [Pubmed|32849357,22408163], in [regulon|protein:5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8752328], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]→[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]

2022-05-12 14:03:22

ghost

13

937063a9a54ed4e12875306102d73517e6ee5839

8CD6FD61ACBEF014C97BE839B61E435F9EC8941B

Biological materials
Mutant
1A1056 ( ''gbsB''::''kan''), [Pubmed|21296969], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1056&Search=1A1056 BGSC]
BKE31050 (Δ[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAATGTCATCATCAATCTCC,  downstream forward: _UP4_TAATCAAAATCCCGCTCCTT
BKK31050 (Δ[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAATGTCATCATCAATCTCC,  downstream forward: _UP4_TAATCAAAATCCCGCTCCTT
labs
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
References
8752328,21296969,22408163,29159878,19011020

B90D4E798145F2AF3421DDC5AB6CD578E2E17900

Page visits: 1537

Time of last update: 2022-08-08 19:17:13

Author of last update: Melvin.boenninger