yhcN

yhcN
168

spore lipoprotein

locus
BSU_09150
Molecular weight
20.84 kDa
pI
5.36
Protein length
Gene length
function
efficient spore [wiki|germination]
product
unknown
essential
no
synonyms
yhcN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5912

This gene is a member of the following regulons

Gene
Coordinates
989,022 → 989,591
Phenotypes of a mutant
reduced rate of spore [wiki|germination] in L-alanine [pubmed|28333204]
The protein
[wiki|Domains]
aa 1 - 24: lipobox (signal peptide and Cys for lipid binding) [pubmed|34808342]
aa 78 - 189: ring-building motif (RBM) domain [pubmed|34808342]
Structure
[PDB|7PEG] [pubmed|34808342]
[AF|P54598]
[wiki|Localization]
forespore inner membrane (according to UniProt)
membrane around foreshores from 3 hrs after onset of [category|SW.4.2|Sporulation] [pubmed|34808342]
Expression and Regulation
Operons
genes
[gene|BA0E4135244D214B435836F07F608818A31B7E52|yhcN]
description
[Pubmed|9611260]
regulation
expressed during sporulation ([protein|search|SigF], [protein|search|SigG]) [Pubmed|9611260]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|9611260], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|9611260,15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|BA0E4135244D214B435836F07F608818A31B7E52|yhcN]

2022-12-15 16:44:27

ghost

33

eeaf7b2f24faa27194d86cb6ab4eb3ad9017de72

7E238CB10A81EC0BA05C2738003784BB2046A60F

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-A671 (yhcN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/671 NBRP B. subtilis, Japan]
1A924 ( ''yhcN''::''erm''), [Pubmed|12813063], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A924&Search=1A924 BGSC]
BKE09150 (Δ[gene|BA0E4135244D214B435836F07F608818A31B7E52|yhcN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATTCCTCCTTTAT,  downstream forward: _UP4_TAAATGAAAGAAGCCGCACA
BKK09150 (Δ[gene|BA0E4135244D214B435836F07F608818A31B7E52|yhcN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATTCCTCCTTTAT,  downstream forward: _UP4_TAAATGAAAGAAGCCGCACA
References
16497325,9611260,26731423,28333204,30782632,34808342

BA0E4135244D214B435836F07F608818A31B7E52

Page visits: 2764

Time of last update: 2023-02-05 02:29:02

Author of last update: Jstuelk