yitG

yitG
168

similar to multidrug resistance protein

locus
BSU_10980
Molecular weight
45.35 kDa
pI
9.74
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yitG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
1,175,985 → 1,177,253
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|Q796Q1]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]-[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [Pubmed|16497325,15699190]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325,15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]→[gene|F1A84EC28BE0E306356A331FD362E3CDAE49A3AB|yitF]

2022-11-23 10:39:51

Jstuelk

14

1a7654e00c5d5a0b2d8d71b0ce746268fb284c6b

ACE0D92BED56C545654A63C0D67166D7CDABC35E

additional information
[protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Biological materials
Mutant
MGNA-B181 (yitG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1180 NBRP B. subtilis, Japan]
BKE10980 (Δ[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGAGCACACTCCTT,  downstream forward: _UP4_GCTGAGGAAAGGTAGCACCC
BKK10980 (Δ[gene|BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2|yitG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGAGCACACTCCTT,  downstream forward: _UP4_GCTGAGGAAAGGTAGCACCC
References
16497325,15699190,10960106

BA1A7ECAE0B5690F6E6A67785BAB18628701E2A2

Page visits: 1386

Time of last update: 2022-11-30 04:25:11

Author of last update: Melvin.boenninger