ybfO

ybfO
168

similar to erythromycin esterase

locus
BSU_02310
Molecular weight
51.62 kDa
pI
6.68
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybfO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2312

This gene is a member of the following regulons

Gene
Coordinates
249,979 → 251,319
The protein
Structure
[PDB|2QGM] (23% identity)
[AF|O31455]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]-[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]
description
[Pubmed|12207695]
regulation
repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]) [Pubmed|18840696]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696,20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]→[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]

2022-12-02 12:45:08

Jstuelk

38

50a945625df291fbb5df9027fa7857ca92a76e0e

38EAB2C0FEF8D67A055D05FB47AFE694C464191E

genes
[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]
description
[Pubmed|20817675]
regulation
repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]) [Pubmed|18840696]
Open in new tab

[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]→[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]

2022-11-28 18:24:25

Jstuelk

18

fe15add8629dec9297e9ad34a6ce932400a411a1

44F8E545FEA0CBD4F342C5F2356F2692EFBA9996

genes
[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]
description
(according to [http://dbtbs.hgc.jp/COG/prom/ybfO.html DBTBS]) null
regulation
repressed during logarithmic growth ([protein|search|AbrB]) [Pubmed|18840696]
additional information
[protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Open in new tab

[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]

2022-12-01 03:54:55

ghost

22

6d97d277f540db357f4c18f2fd025bbbb85d0783

94768F983E7CF5D42D5AC82094A0CAE07A1A8186

additional information
[protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Biological materials
Mutant
MGNA-B935 (ybfO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1934 NBRP B. subtilis, Japan]
BKE02310 (Δ[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTCTATCTCTCCTTTTC,  downstream forward: _UP4_TGAGCGGTGTCCCCTGTGGT
BKK02310 (Δ[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTCTATCTCTCCTTTTC,  downstream forward: _UP4_TGAGCGGTGTCCCCTGTGGT
References
18957862,11866510,18840696,12207695,20817675

BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664

Page visits: 1735

Time of last update: 2022-12-01 07:19:47

Author of last update: Jstuelk