rapH

rapH
168

response regulator aspartate phosphatase, dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]-P, control of the phosphorelay, control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity

locus
BSU_06830
Molecular weight
49.96 kDa
pI
6.12
Protein length
Gene length
function
control of sporulation initiation and [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity
product
response regulator aspartate phosphatase
essential
no
synonyms
rapH, yeeH, yzqA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
750,959 → 752,089
The protein
Catalyzed reaction/ biological activity
binds to and thereby inhibits [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity [Pubmed|17581123]
RapH dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]-P and thereby controls the [wiki|phosphorelay] [Pubmed|17581123]
in addition to dephosphorylating [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F], RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]  [Pubmed|21346797]
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[PDB|3Q15] ([protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]-[protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F] complex) [Pubmed|21346797]
Effectors of protein activity
interaction with [protein|4FA7D6E6316A6FC71C10C692D125833263894020|phrH] inhibits dephosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F] and sequestration of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] by [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH] [Pubmed|21908671]
Expression and Regulation
Operons
genes
[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]-[gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]
description
[Pubmed|21908671]
regulation
''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
regulatory mechanism
[protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR]: repression, [Pubmed|16553878], in [regulon|protein:972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR regulon]
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, [Pubmed|11948146,11918817], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21908671], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]→[gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]

2022-11-22 15:16:21

ghost

39

afdfd4e58aa462c1f34c8519b1214c943fc47156

3178B428D9699AC0C49193C0A58CC78CB3717A7F

Biological materials
Mutant
MGNA-A013 (rapH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/13 NBRP B. subtilis, Japan]
BKE06830 (Δ[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGGCTTCCCTCCTTCTC,  downstream forward: _UP4_GATATTCTAAAAGGAGAGTG
BKK06830 (Δ[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGGCTTCCCTCCTTCTC,  downstream forward: _UP4_GATATTCTAAAAGGAGAGTG
References
16553878,17581123,11948146,11918817,20817675,21346797,21908671

BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8

Page visits: 4359

Time of last update: 2022-11-27 13:17:47

Author of last update: Melvin.boenninger