

polyketide synthase of type I

Molecular weight
505.85 kDa
Protein length
Gene length
polyketide synthesis
polyketide synthase of type I
pksL, pksX, pksA, outG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3321

This gene is a member of the following regulons

1,807,921 → 1,821,537
The protein
5 [wiki|Carrier domain]s (aa 320-394, aa 1800-1873, aa 2597-2674, aa aa 2738-2815, aa 3960-4037) (according to UniProt)
[PDB|5ENY] [Pubmed|26724270]
Expression and Regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab


2022-09-24 18:40:05





Open in new tab


2022-09-24 18:41:08





Biological materials
BKE17190 (Δ[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTTAGACCTCCACCTCATA,  downstream forward: _UP4_TTCAAATAAGAGAGGAGTGG
BKK17190 (Δ[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTTAGACCTCCACCTCATA,  downstream forward: _UP4_TTCAAATAAGAGAGGAGTGG


Page visits: 2808

Time of last update: 2022-09-28 11:55:06

Author of last update: Melvin.boenninger