yfhP

yfhP
168

unknown

locus
BSU_08620
Molecular weight
36.97 kDa
pI
9.15
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfhP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1988

This gene is a member of the following regulons

Gene
Coordinates
934,457 → 935,440
The protein
Catalyzed reaction/ biological activity
may act as negative regulator of transcription of the ''[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]-[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]'' operon [Pubmed|10463184]
Structure
[AF|O31583]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]
description
[Pubmed|10463184]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|10463184]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|10463184], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]

2022-11-28 19:08:14

ghost

13

1abd68c2a6961d8eedd154c00fc236724f28accb

9BC3AECEFFDE586E69B07315584C5C9949E9E40B

Biological materials
Mutant
MGNA-C321 (yfhP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2319 NBRP B. subtilis, Japan]
BKE08620 (Δ[gene|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGGTGACCTCCTTGCAG,  downstream forward: _UP4_CTTCAGAAAAAATTAAAGCT
BKK08620 (Δ[gene|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGGTGACCTCCTTGCAG,  downstream forward: _UP4_CTTCAGAAAAAATTAAAGCT
References
10463184

BB4007ADF92649730C9F9A26FD082ABC8CFA1E48

Page visits: 1090

Time of last update: 2022-11-28 07:02:57

Author of last update: Jstuelk