ykfD

ykfD
168

similar to oligopeptide [wiki|ABC transporter ](permease)

locus
BSU_13000
Molecular weight
36.83 kDa
pI
9.34
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykfD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0444

This gene is a member of the following regulons

Gene
Coordinates
1,368,844 → 1,369,833
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 7-252) (according to UniProt)
Structure
[PDB|4FWI] (dipeptide transporter from ''Thermoanaerobacter tengcongensis'', 36% identity) [Pubmed|23385461]
[AF|C0SP98]
Paralogous protein(s)
[protein|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|oppF], [protein|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF], [protein|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD], [protein|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD], [protein|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]
[wiki|Localization]
attached to the cell membrane (via [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
description
[pubmed|22383849]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]->[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]

2022-11-21 06:17:37

Bzhu

38

9978370314fc05087eca13c4f3ce94e92ce93ff2

E2A0CC9BE866DBD9F0E3A5F48EE05465C14EFD9D

Biological materials
Mutant
MGNA-A743 (ykfD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/743 NBRP B. subtilis, Japan]
BKE13000 (Δ[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTCCCTCCTTATT,  downstream forward: _UP4_TAAATAAAAAGAGTGGCTCC
BKK13000 (Δ[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTCCCTCCTTATT,  downstream forward: _UP4_TAAATAAAAAGAGTGGCTCC
References
12618455,10092453,23385461

BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F

Page visits: 1472

Time of last update: 2022-11-25 16:52:11

Author of last update: Melvin.boenninger