wapA

wapA
168

cell wall-associated protein precursor, contact-dependent growth inhibition protein

locus
BSU_39230
Molecular weight
258.02 kDa
pI
6.13
Protein length
Gene length
function
intercellular competition
product
cell wall-associated protein precursor
essential
no
synonyms
wapA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3209

This gene is a member of the following regulons

Gene
Coordinates
4,023,544 → 4,030,548
The protein
Catalyzed reaction/ biological activity
the C-terminal toxic domain has RNase activity (cleaves tRNAs) [Pubmed|23572593]
Protein family
RHS/WapA nuclease family (single member, according to UniProt)
[wiki|Domains]
cell wall binding domain as retention signal
C-terminal toxic domain with RNase activity (cleaves tRNAs) [Pubmed|23572593]
Has two ligand-binding domains; the N-terminus has three 101 AA repeats which are responsible for cell wall binding; the C-terminus consists of two blocks of residues with a conserved motif repeated 31 times (according to UniProt)
Structure
[AF|Q07833]
Effectors of protein activity
[protein|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI] inhibits the toxic activity of [protein|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA] [Pubmed|23572593]
[wiki|Localization]
extracellular (signal peptide), cell wall binding domain as retention signal, major constituent of the secretome [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA]-[gene|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI]
description
[Pubmed|16306698]
regulation
repressed at high salt concentration ([protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P) [Pubmed|9537385]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|9537385], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
[protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]: repression, [Pubmed|23199363], in [regulon|protein:7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23199363], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA]→[gene|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI]

2022-11-18 22:18:07

Jstuelk

37

ACCB16F95EA75BBC03E1DD4186EAB71F0DEDFADE

84D822AFD36349840C746076174D4353AE6A1D3C

Biological materials
Mutant
BKE39230 (Δ[gene|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCTCTCCTTTTGT,  downstream forward: _UP4_TAATAAGGTTAAGCGAGGGG
BKK39230 (Δ[gene|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCTCTCCTTTTGT,  downstream forward: _UP4_TAATAAGGTTAAGCGAGGGG
References
11987133,16672620,18957862,16306698,9537385,21821766,23572593,23199363,25666134,26923784,28827522,32419322,35171018

BBC06DA57CAC2B2378763E0839C6C31AFBEA0417

Page visits: 5104

Time of last update: 2022-11-29 03:36:56

Author of last update: Jstuelk