yrkC
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

yrkC
168

mother cell-specific sporulation protein

locus
BSU_26560
Molecular weight
21.11 kDa
pI
7.35
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yrkC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0662

This gene is a member of the following regulons

Gene
Coordinates
2,714,933 → 2,715,493
The protein
[wiki|Domains]
[wiki|cupin 2 domain] (aa 89 ... 164)
Structure
[PDB|2OA2] (the [wiki|cupin 2 domain], from B. halodurans, 66% identity)
[AF|P54430]
Expression and Regulation
Operons
genes
[gene|BBF2D58DFC1E345BB841AFDFEF5E651715B1426B|yrkC]-[gene|B97A503AA247375DCA28009A7D3895F6327BE3F5|yrzN]
description
[Pubmed|22383849,12480901]
regulation
expressed late during sporulation in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]) [Pubmed|15699190,12480901]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,12480901], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|BBF2D58DFC1E345BB841AFDFEF5E651715B1426B|yrkC]→[gene|B97A503AA247375DCA28009A7D3895F6327BE3F5|yrzN]

2022-06-24 02:36:26

Jstuelk

8

be2f1ea5d7ac7680a9a61411d74b1f1a9cfcd596

45CA261B697F96834F07464F01E80145743751D8

Biological materials
Mutant
MGNA-C456 (yrkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2454 NBRP B. subtilis, Japan]
BKE26560 (Δ[gene|BBF2D58DFC1E345BB841AFDFEF5E651715B1426B|yrkC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTGATCCCCGCAAT,  downstream forward: _UP4_TAGCACAGATATTCTGGAGA
BKK26560 (Δ[gene|BBF2D58DFC1E345BB841AFDFEF5E651715B1426B|yrkC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTGATCCCCGCAAT,  downstream forward: _UP4_TAGCACAGATATTCTGGAGA
References
15699190,12480901

BBF2D58DFC1E345BB841AFDFEF5E651715B1426B

Page visits: 796

Time of last update: 2022-08-12 14:57:17

Author of last update: Jstuelk