glcT

glcT
168

transcriptional antiterminator, controls expression of the [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] operon

locus
BSU_13880
Molecular weight
33.03 kDa
pI
7.01
Protein length
Gene length
function
control of glucose uptake
product
transcriptional antiterminator of the [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] operon
essential
no
synonyms
glcT, ykwA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3711

This gene is a member of the following regulons

Gene
Coordinates
1,456,092 → 1,456,958
The protein
Catalyzed reaction/ biological activity
[wiki|PRD-containing transcription factors|transcription antiterminator] , RNA-binding protein, binds the ''[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]'' RAT sequence
Protein family
[wiki|PRD-containing transcription factors]
[wiki|Domains]
RNA-binding domain (N-terminal, constitutive antiterminator)
2x [wiki|PTS] regulation domains ([wiki|PRD]s) (C-terminal, neg. regulated by [protein|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG])
Structure
[PDB|3RIO] (RBD-[wiki|PRD]-I) [Pubmed|22750856]
[PDB|3GWH] ([wiki|PRD]-II) [Pubmed|19684596]
[AF|O31691]
Modification
phosphorylation (His104)
Paralogous protein(s)
[protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY], [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT], [protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
Expression and Regulation
Operons
genes
[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]-[gene|6FDE01EEFCDB2F949A902DFD76A341410B867E88|ykvZ]-[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]
description
[Pubmed|22383849]
Open in new tab

[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]→[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]

2022-12-07 16:54:32

Jstuelk

19

25102c23992d19390a5e8e4804e2cbb1f6144844

98F4AE67839A721B68CFC3DAE296D719BD229B45

Biological materials
Mutant
available in [wiki|Jörg Stülke]'s lab:
GP109 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT], in frame deletion)
GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
GP926 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::tet) [Pubmed|22722928]
BKE13880 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAATACCTCATATCGT,  downstream forward: _UP4_TAAATTCAGTTTATCCTTAT
BKK13880 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCAATACCTCATATCGT,  downstream forward: _UP4_TAAATTCAGTTTATCCTTAT
Expression vectors
pGP124 (full length, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP114 (amino acids 1-60, RNA-binding domain, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP230 (amino acids 1-60, RNA-binding domain with thrombin cleavage site, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP164 (both PRDs, in [wiki|pWH844]), in addition diverse Expression vector for phosphorylation site mutants and for RBD mutants (all in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP424 (PRDI, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP425 (PRDII, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP442 (PRDI, in [wiki|pGP570], with thrombin cleavage site), available in [wiki|Jörg Stülke]'s lab
pGP443 (PRDII, in [wiki|pGP570],  with thrombin cleavage site), available in [wiki|Jörg Stülke]'s lab
pGP575 (amino acids 1-60, RNA-binding domain with Strep-tag, in [wiki|pGP574]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1220 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1224 (spc, based on [wiki|pGP1870]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
References
Reviews
9663674,18086213
Original Publications
11902727,9765562,12437213,10543968,17074746,15155854,14527945,19684596,22722928,20939030,22750856,30082753

BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449

Page visits: 3211

Time of last update: 2022-12-08 14:15:26

Author of last update: Jstuelk