SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


response regulator aspartate phosphatase, dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]-P

Molecular weight
44.25 kDa
Protein length
Gene length
control of the [wiki|phosphorelay]
response regulator aspartate phosphatase
rapJ, ycdE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0457

This gene is a member of the following regulons

304,430 → 305,551
The protein
Catalyzed reaction/ biological activity
dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]-P [Pubmed|21346797]
Protein family
[wiki|RAP family] (according to UniProt)
RapJ is made up of the C-terminal tetratricopeptide repeat (TPR) domain (five [wiki|TPR repeat|tetratrichopeptide repeats]) that is connected by a flexible helix containing linker to the N-terminal 3-helix bundle. Upon binding of the regulating peptide [protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC], the 3-helix bundle and the linker helix undergo a conformational change to form a TPR-like fold that merges with the existing C-terminal TPR domain. [Pubmed|23526881]
[PDB|4GYO] (complex [protein|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]-[protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]) [Pubmed|23526881]
Effectors of protein activity
the interaction with [protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC] inactivates [protein|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ] [Pubmed|23526881]
Expression and Regulation
Open in new tab


2021-10-20 06:05:47





Biological materials
BKE02820 (Δ[gene|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCTGCCTCCTTCCT,  downstream forward: _UP4_TAGGAAATGGCAGAGAACTA
BKK02820 (Δ[gene|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCTGCCTCCTTCCT,  downstream forward: _UP4_TAGGAAATGGCAGAGAACTA


Page visits: 1293

Time of last update: 2021-12-08 12:01:37

Author of last update: Melvin.boenninger