
At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!


NADH oxidase

Molecular weight
22.19 kDa
Protein length
Gene length
regeneration of NAD from NADH
NADH oxidase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0778

This gene is a member of the following regulons

2,127,813 → 2,128,421
The protein
Catalyzed reaction/ biological activity
regeneration of NAD from NADH [Pubmed|26312069]
Protein family
[wiki|nitroreductase family] (according to UniProt)
[PDB|3GE6] (from '' Exiguobacterium sibiricum'', 42% identity)
Expression and Regulation
regulatory mechanism
[protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB]: repression, [Pubmed|18208493], in [regulon|protein:73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB regulon]
Open in new tab


2022-04-21 03:48:12





Biological materials
MGNA-B434 (yodC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1433 NBRP B. subtilis, Japan]
BKE19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG,  downstream forward: _UP4_TAAGGATATGAAAAACCTTA
BKK19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG,  downstream forward: _UP4_TAAGGATATGAAAAACCTTA


Page visits: 1198

Time of last update: 2022-05-20 14:58:07

Author of last update: Melvin.boenninger