pupG

pupG
168

purine nucleoside phosphorylase

locus
BSU_23490
Molecular weight
28.98 kDa
pI
4.86
Protein length
Gene length
function
purine salvage and interconversion
product
purine nucleoside phosphorylase
essential
no
ec
2.4.2.1
synonyms
pupG, punA, pnp, yqkO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0005

This gene is a member of the following regulons

Gene
Coordinates
2,446,418 → 2,447,233
The protein
Catalyzed reaction/ biological activity
purine 2'-deoxy-D-ribonucleoside + phosphate --> 2-deoxy-α-D-ribose 1-phosphate + purine nucleobase (according to UniProt)
Protein family
PNP/MTAP phosphorylase family (single member, according to UniProt)
Structure
[PDB|3LA8] (from Streptococcus mutans, 57% identity)
[AF|P46354]
Modification
phosphorylation on Ser-28 [Pubmed|17218307]
[wiki|Localization]
secreted (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]-[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]
description
[Pubmed|10537218]
regulation
induced in the presence of nucleosides (deoxyribose 5-phosphate and ribose 5-phosphate act as molecular inducers) [Pubmed|10537218]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10537218], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]→[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]

2022-09-20 12:08:36

ghost

17

14c764b577f7631beda537db900a102a9f367490

F338011D0443A78E516CD55DF097CFDB8967EE05

Biological materials
Mutant
BKE23490 (Δ[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTGTCCTTCAAGAAACAGT,  downstream forward: _UP4_TAAATATGAATCAATGCAGG
BKK23490 (Δ[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTGTCCTTCAAGAAACAGT,  downstream forward: _UP4_TAAATATGAATCAATGCAGG
References
10537218,22900538,17218307

BC6FA7677AAE6BA24530D125007A18056D75DADF

Page visits: 4380

Time of last update: 2022-10-06 08:02:06

Author of last update: Melvin.boenninger