hutP

hutP
168

transcriptional antiterminator of the [gene|search|hut ]operon

locus
BSU_39340
Molecular weight
16.43 kDa
pI
6.06
Protein length
Gene length
function
regulation of histidine utilization
product
transcriptional antiterminator
essential
no
synonyms
hutP, hutP1

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,041,483 → 4,041,938
The protein
Protein family
hutP family (single member, according to UniProt)
[wiki|Cofactors]
Mg2+ [pubmed|29035529]
L-His [pubmed|23748184]
Structure
[PDB|3BOY] (complex bound  to the [gene|search|hut] mRNA),  [PDB|1WPT]
[AF|P10943]
Effectors of protein activity
HutP binds its RNA target to cause antitermination in the presence of histidine [Pubmed|23748184]
Expression and Regulation
Operons
genes
[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]-[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]-[gene|ED6002BB56B96F9A2B4F80CA050518B266000E55|hutU]-[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]-[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]-[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]
description
[Pubmed|10746760]
regulation
induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8071225], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8682780], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]: antitermination, at a protein-dependent [wiki|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|protein:BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8071225], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]→[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]

2022-11-24 23:26:18

ghost

36

cf3eb91928f3fe61cbc0cd204535c4f9c144314a

0AE45FCE38B0E774CFFC5F6A0A98EEDF6B02F4D4

Biological materials
Mutant
BKE39340 (Δ[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCACTCAATTCC,  downstream forward: _UP4_TGAAACAGCCCATAGATCTT
BKK39340 (Δ[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCACTCAATTCC,  downstream forward: _UP4_TGAAACAGCCCATAGATCTT
References
Reviews
17395359,16427271,22933560,31100987
Research papers
28510182,23748184,10712704,18445631,15758992,15242603,14763987,15273277,18445631,8071225,16192572,29035529

BCA2700F27CA7A0C3FC08AAEBE615A783A42F408

Page visits: 2051

Time of last update: 2022-11-29 02:15:55

Author of last update: Jstuelk