SubtiWiki SubtiWiki
yvmC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yvmC
168

cyclodipeptide synthase

locus
BSU_35070
Molecular weight
28.36 kDa
pI
6.61
Protein length
Gene length
function
biosynthesis of the extracellular iron chelator pulcherrimin
product
cyclodipeptide synthase
essential
no
synonyms
yvmC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,603,821 → 3,604,567
The protein
Catalyzed reaction/ biological activity
synthesis of the cyclic dipeptide cyclo-L-leucyl-L-leucyl with the corresponding charged tRNAs as substrates in an ATP-dependent manner [Pubmed|19430487]
2 L-leucyl-tRNALeu --> cyclo(L-leucyl-L-leucyl) + 2 H+ + 2 tRNALeu (according to UniProt)
Protein family
CDPS family (single member, according to UniProt)
Structure
[PDB|3S7T] (from ''B. licheniformis'', 70% identity, 86% similarity) [Pubmed|21325056]
Expression and Regulation
Operons
genes
[gene|BCE1D8CDDF07396583FF50C4C192785545244BE2|yvmC]-[gene|D63EDBB6AA33708E8352F6208A9BA18CAEE0DC53|cypX]
description
[http://www.liebertonline.com/doi/pdf/10.1089/ind.2006.2.66 Reference]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]: repression, in [regulon|protein:0D555F2AB7DC863E6FF388888308E980514DB719|pchR regulon]
Open in new tab

[gene|BCE1D8CDDF07396583FF50C4C192785545244BE2|yvmC]→[gene|D63EDBB6AA33708E8352F6208A9BA18CAEE0DC53|cypX]

2021-12-29 02:46:48

ghost

5

0335f16608554630bb979b2ec3e5321773d5d3c3

3B02729FC2C4AD75A2BFE99E2ED90819DABC19B4

Biological materials
Mutant
BKE35070 (Δ[gene|BCE1D8CDDF07396583FF50C4C192785545244BE2|yvmC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCATTCACCCCTAAAA,  downstream forward: _UP4_TGATAGGGGGAGTAAAACAT
BKK35070 (Δ[gene|BCE1D8CDDF07396583FF50C4C192785545244BE2|yvmC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCATTCACCCCTAAAA,  downstream forward: _UP4_TGATAGGGGGAGTAAAACAT
References
19430487,220817675,21325056,27542896,31113899,4204912

BCE1D8CDDF07396583FF50C4C192785545244BE2

Page visits: 2371

Time of last update: 2022-01-17 18:43:05

Author of last update: Melvin.boenninger